In 2014, some registered native grapevine cultivars from Apulia were analyzed to determine their "absolute" sanitary status (virome) i.e. the totality of virus, viroids and phytoplasmas, present in any single accession, using a high throughput sequencing (HTS) approach (Giampetruzzi et al., 2015). Small RNA libraries synthesized from a symptomless red-berried wine grapevine of cv. Bombino nero (accession D205), growing in a foundation block, showed the presence of 21 contigs (ranging from 329 to 56 nucleotides in length) which, upon BLASTX analysis (Altschul et al., 1997), were identified as badnavirus-like sequences. To confirm deep-sequencing findings, a set of PCR specific primers (11for-G: 5’CAAAGTAAGAGCAATCCTTGATACCGG3’; 13rev-G: 5’ CCCAATGTTACAGATCACCATCTCCTG3’) were designed, using the closest reference sequence, i.e. Fig badnavirus 1 (FBV-1, GenBank Accession no. NC017830). A product of the expected size (410 bp) was amplified and custom-sequenced, showing ca. 91% identity at the nucleotide level with the sequence of a badnavirus recently discovered in Greece (Maliogka et al., 2015) and denoted Grapevine Roditis leaf discoloration-associated virus (GRLDaV, NC027131). For a preliminary assessment of the incidence of this virus in the field, a preliminary survey in the same foundation block was conducted. A total of 11 samples from different autochthonous cultivars were checked by PCR, but none of them tested positive. It is worth nothing that accession D205 is a registered clone, which has been inspected for years by laboratory testing and field indexing without revealing the presence of regulated viruse, nor showing symptoms. To our knowledge, this is the first report of GRLDaV in Italy.

First report of grapevine roditis leaf discoloration-associated virus in Italy

GIAMPETRUZZI, ANNALISA;SAVINO, Vito Nicola;
2015-01-01

Abstract

In 2014, some registered native grapevine cultivars from Apulia were analyzed to determine their "absolute" sanitary status (virome) i.e. the totality of virus, viroids and phytoplasmas, present in any single accession, using a high throughput sequencing (HTS) approach (Giampetruzzi et al., 2015). Small RNA libraries synthesized from a symptomless red-berried wine grapevine of cv. Bombino nero (accession D205), growing in a foundation block, showed the presence of 21 contigs (ranging from 329 to 56 nucleotides in length) which, upon BLASTX analysis (Altschul et al., 1997), were identified as badnavirus-like sequences. To confirm deep-sequencing findings, a set of PCR specific primers (11for-G: 5’CAAAGTAAGAGCAATCCTTGATACCGG3’; 13rev-G: 5’ CCCAATGTTACAGATCACCATCTCCTG3’) were designed, using the closest reference sequence, i.e. Fig badnavirus 1 (FBV-1, GenBank Accession no. NC017830). A product of the expected size (410 bp) was amplified and custom-sequenced, showing ca. 91% identity at the nucleotide level with the sequence of a badnavirus recently discovered in Greece (Maliogka et al., 2015) and denoted Grapevine Roditis leaf discoloration-associated virus (GRLDaV, NC027131). For a preliminary assessment of the incidence of this virus in the field, a preliminary survey in the same foundation block was conducted. A total of 11 samples from different autochthonous cultivars were checked by PCR, but none of them tested positive. It is worth nothing that accession D205 is a registered clone, which has been inspected for years by laboratory testing and field indexing without revealing the presence of regulated viruse, nor showing symptoms. To our knowledge, this is the first report of GRLDaV in Italy.
File in questo prodotto:
File Dimensione Formato  
3418-2693-2-PB.pdf

non disponibili

Tipologia: Documento in Versione Editoriale
Licenza: NON PUBBLICO - Accesso privato/ristretto
Dimensione 52.75 kB
Formato Adobe PDF
52.75 kB Adobe PDF   Visualizza/Apri   Richiedi una copia

I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.

Utilizza questo identificativo per citare o creare un link a questo documento: https://hdl.handle.net/11586/185873
Citazioni
  • ???jsp.display-item.citation.pmc??? ND
  • Scopus 13
  • ???jsp.display-item.citation.isi??? ND
social impact